Biology Resources - PBworks

Biology Resources Set 2: Answers for Structured Note-Taking Biology- The study of living things Who: Biologist - Interactions between living things - Interactions between living things and the environment - Problems to find solutions 1. Cells & DNA Living thing-organism 5 Characteristics: 1. Cells & DNA 2. Reproduce 3.Grow & Develop 4. Homeostasis 5. Adapt 5 Cell- basic unit of life DNA- genetic info 2. Reproduce *to further the species Species: group of similar organisms that can interbreed and have fertile offspring 3. Grow Become larger Develop Mature, become like an adult 4. homeostasis *internal balance (kidneys sweating) Without it, you will die! 5. Adapt

Adaptation: help you survive in environment Evolution: change in species over time SCIENTIFIC METHOD- a series of steps to solve a scientific problem 1. Problem 2. Hypothesis 3. Experiment 4. Data 5. Results 6. Conclusion 7. R/R or Repeat ----------------------------------- 7 1. Problem- scientific * Cannot be opinion * Give ex of opinion vs scientific 2. Hypothesis- a testable statement *give example 3. Experiment -a test of a hypothesis Independent variable: tested Dependent variable: measured Constant: same Control: normal to measure against 4. Data- info collected Quantitative Qualitative - n - numbers - 5 ft, 7.2 inch - L - letters, words, descriptive

5. Results- charts/graphs 6. Conclusion 7. Revise / Redo or Repeat -R/R- hypo wrong - Repeat- hypo right Why repeat: to verify results WATER Properties: Polar- Great solvent Water is Polar --Like dissolves like---Polar dissolves polar- Non-polar= oils, fats - will not dissolve Hydrogen Bonds: - gives H2O special properties - make/break rapidly 3 Things H2O does: 1. Capillary action Good- H2O to tops of trees 2. Stabilizes temp, holds heat (Good) NC ocean- mild climate Desert- hot day, freezing night 3. Expands when freezes less dense Good- floats Water does these things because of Hydrogen bonds ACID BASE pH: 1-7 Gives- H+

burns Ex: lemon juice, stomach pH: 7-14 Gives- OHSoapy, cleaning Ex: cleaners, ammonia acid 7 pH scale Neutral H2O Buffer Maintains constant pH Ex. Blood buffer Organic = has Carbon Living things have C Polymer Monomer long chain of repeating units one unit Ex. Train car Ex.train [o] [o][o]---[o]---[o] 4 Classes of organics Carbs

Protein Nucleic Acid Lipid O R G A N I C [S]-[U]-[G]-[A]-[R] CARBOHYDRATES Polymer- polysaccharide Monomer- monosaccharide Uses quick Energy Ex. Starch, sugar, fiber Foods plant products/ fruit, veggies PROTEIN (A)-(M)-(I)-(N)-(O)-(A)-(C)-(I)-(D) Polymer- polypeptide (protein) Monomer- amino acid Uses hair skin enzymes Food animal products, beans Ex. Enzymes (go to enzyme side) Nucleic Acid Monomer- nucleotide Ex. DNA/RNA Importance genetic info LIPID fats and oils Enzymes A type of protein Subunit of protein amino acid Job- Biological Catalyst Affected by: temp & pH Needed for: Biological Functions Lock and Key Model

nonpolar Meaning will not dissolve in H2O Found in mayonnaise, butter Greasy, oily E are not consumed/used In out M Microscope Types: Before Microscopes: sick because cursed or punished for bad deed Microscope tool used to look at small organisms Micro small Scope to look at Microscopes allow US to see cells! Cell basic unit of life 1. Simple light 1st type 1 lens Energy Source light I LOW magnification power Light C 2.2+ Compound lenses Energy source light R Lens= 10 Objective = 4 OTotal Magnification = 40 Up to about 1500 Xs S 3. Electron Microscopes C Uses beam of electrons Magnify up to 500,000 Xs O SEM TEM

P scanning e- transmission emicroscope microscope E surface inside Match the part with the letter Parts: Objectives, Diaphragm, Lens, Coarse Adjustment, Light Source, Arm, Stage, Fine Adjustment A. Fine Adjustment E. Stage B. Lens F. Diaphragm C. Light Source G. Objectives D. Coarse Adjustment H. Arm Answer Questions using Parts 1. __D__Used to bring objects into rapid focus first 2. __F__ Regulates the amount of light going through slide 3. __H__ Used to carry the microscope 4. __E__ Supports the slide 5. __A__ Turned to clear blurry pictures Answer Questions: How do you carry a microscope?- by the arm If the lens is 10 and the objective is 4, what is the total magnification?- 40 Famous Men Leeuwenhoek: saw microorganisms Used a simple microscope Robert Hooke: named a cell

Used a compound microscope Looked at cork- C Hooke , Schleiden , Schwann Cells Plants Animals E CELL THEORY All living things are made of cells L 1. unicellular1 cell L multicellular- 2+ cells 2. Cell is the basic unit of life Reminded him of rooms in a monastery Called cells T. Schwann: sounds like Swan All animals made of cells M. Schleiden: All plants made of cells Since all plants and animals are made of cells they concluded that T cells organ organisms HThe beginning Organ tissue unit is always a cell system E muscle O skin skin R muscle 3. All cells come from other cells skin muscle Y P

Plasma MembraneL A S Plasma Membrane outer M boundary of a cell - skin A Job- to maintain homeostasis Homeostasis internal balance PM is selectively permeable selectively- choosy Permeable allows to pass Selectively permeable chooses what it allows to pass PM balanced Good in Bad out M E M B R A N E Structure Polar head Tails non-polar (hydrophobic) phospholipids bilayer Polar: heads outside Non-polar: tails inside hiding from H2O Fluid mosaic model flexible Embedded w/ protein Perm mem nucleus nucleus

Animal cell Cell organelles organs in a cell organelle Most important = nucleus Nucleus controls all cell function Nucleus:Cell :: brain:body C E L L S 2 Cell Types Prokaryote Eukaryote no nucleus nucleus no int membrane int membrane simple complex 1 job at a time multitask bacteria only plants/animals Internal Membranes separate the cell into compartments Membranes : Cell :: walls: School Jobs separate -divide -allow to multiply

prokaryote eukaryote Cell Theory 1.All living things made of cells 2. Cell is basic unit of life 3.All cells come from pre-existing cells Prokaryote simple Eukaryote complex no nucleus nucleus no interior int membrane membrane Nucleus is to cell as Nucleus: controls all cell function Brain is to body C E L L S Plasma Membrane Plasma membrane is to cell as Skin is to body RF: center covering Job: homeostasis Structure: phospholipids bilayer fluid mosaic model Polar heads outside Nonpolar tails inside away from water

Other Cell Organelles Cell wall Cell wall is to cell as hard exterior covering Helmet is to head Made of: cellulose Relating factor: Int mem is to cell as Internal Membrane: separate cell into Wall is to school rooms RF: divide Gives: extra protection RF: hard protection Note plants only Ribosome: ribosome is to cell as Protein factory is to city RF: makes protein 2 types: free bound Vacuole is to cell as Fridge is to house RF: stores Job make protein job- store food, H2O NOTE plant cell larger Mitochondria:

RF: energy Description- green Chloroplast is to cell job- make food/ as RF: room to make food Description- empty sac Mitochondria is to cell makes energy *You cant live as without PROTEIN* ATP Battery is to object Chloroplast: Kitchen is to house Vacuole: ATP photosynthesis Chlorophyll- traps sunlight NOTE plants only *You cant live without ENERGY!!* Eukaryotes: Have membrane bound organelles Have nucleus Prokaryotes:

Have plasma membrane Have DNA Have Ribs b/c must have protein Concentration: Goal: Amount of solute in solution. Think kool-aid High Lots of solute low not enough solute Solute (green) will move from high to low A B Solute (green) will move to B (think elevators and buffet lines. Where would you rather be?) D I F F U S I O N Concentration Gradient difference in conc on sides Dynamic Equilibrium

equal 5/5 7/3 A B A B To side A A B To side B A B Remember Diffusion movement of a solute to low (less crowded) Driven by: concentration gradient Result: DE Review concentration: (think kool-aid) High Low Too much not enough Dilute add water to lower conc. OSMOSIS movement of water to high Why: to dilute Driven by: CG Result: DE

O S M O S I S Which side needs to be diluted? A So water will go to side A More water on side A because more particles Water will move to side B Why? To dilute high So water flows? in 3 6 3 Shrivels Squishy fruit Swells, could burst Shrivels Animals homeost asis

in out equal O Puts pressure on inside wall S More : out M Water flows: out O Result: shrivels Sides: equal S So: no flow I Result: no pressure S Results: swells 2 Plant 3 Swells Animal 9 Where is there more? in C E L L 3 Cell

Why? To dilute Hypotonic Hypertonic Isotonic Water Flows Water will move to side A 7 8 4 2 4 Passive no energy Happens because there is a Concentration gradient Result- dynamic equilibrium 1. Diffusion 2. Osmosis 3. Facilitated Diffusion Active T R A N S P O R T uses energy Requires energy to: move against

conc grad Result: more unequal 1. pumps 2. carriers 3. endocytosis, exocytosis A B Passive: to side B Active: pumped to side A Cell cycle cycle for cells to make new cells All cells come from pre-existing cells Cells must reproduce DNA in cells chromatin unpacked chromosome packed DNA visible when stained centromere Sister chromatids Cell cycle: M I T O S I S 1. Interphase: grow & DNA duplicate 2. Mitosis: nucleus divides 3. Cytokinesis: cut cell in half

# 1 Source of energy- sun Cell energy- ATP Adenosine Triphosphate APPP Release Energy break bond Store Energy make bond Remove P leaves AP-P (ADP) Remove P leaves A P (AMP) Which has more energy? ATP Why? More P-P bonds *Made in the mitochondria E N E R G Y Photosynthesis Who plants Where chloroplast Job- to make food + O2 Plants take In Out CO2 -O2 water H2O -food sun E Reactant in

Product out Eq: 6CO2+6H2O+E6O2+C6H12O6 Sun chemical food E E E C6H12O6 Cellular Respiration Aerobic Oxygen Where mitochondria Job to make ATP In Anaerobic No oxygen Makes 32+ Makes 2-3 ATP ATP Out O2 CO2 C6H12O6 H2 O Reactant IN E-ATP Product OUT Eq: 6O2+C6H12O6 6CO2+6H2O+E

Notice: Products of PS are reactants in CR Also called fermentation Lactic Acid Fermentation CO2 Alcoholic Fermentation O2 food photosynthesis Cellular respiration Chemistry and Cell Review Acid pH 1-7 H+, burns polar Organic Monomer Base pH 7-14 OH-, cleans Notes and examples 1 carb Monosaccharide sugar 2 protein Amino acid

3 nucleic acid nucleotide 4 lipid ----------Parts of cell theory all living things made of cells the cell is the basic unit of life all cells made from pre-existing cells Leeuwenhoek: saw microorganisms Hooke: saw cells Scleiden: all plants made of cells Schwann: all animals made of cells Cells basic unit of life Cell tissue organ organ system organism Cell Parts Nucleus control Plasma Membrane- outer covering Mitochondria- energy Chloroplast- food- photosynthesis Ribosome- protein Vacuole- store food Plant Chloroplast Cell wall Larger vacuole Animal No chloroplast No cell wall Small vacuole Prokaryote No nucleus PM

Ribosomes DNA Eukaryote Nucleus Other organelles Active Passive Energy Makes more equal 7 2 No energy, makes equal Diffusion, osmosis Facilitated diffusion A Water will flow to A Solute will move to B Why- needs to dilute Why- less concentrated Result- dyn eq Result- dyn eq Process- osmosis Process- diffusion Water goes: in 3

- swell 8 Water goes: out 5 5 - shrivel Water goes: no flow - stable Concentration Gradient Dynamic Equilibrium Difference in conc grad Equal on both sides B Tele A Meta B C Mom Ana D E Prop

F Place the phases in order: D A F C E B and name them Cell Energy ATP Adenosine triphosphate - Energy stored in P-P bonds Photosynthesis IN OUT H2O, CO2, E O2, C6H12O6 Eq: 6CO2+6H2O+E6O2+C6H12O6 Chloroplast mitochondria Cellular Respiration We breathe in O2 We eat C6H12O6 We breathe out CO2 Make H2O + ATP Aerobic Anaerobic Oxygen, more ATP No oxygen, less ATP fermentation DNA deoxyribonucleic acid Codes for genetic info D Gives info to make protein Importance of protein: cant live without protein codes for traits (eye color, hair)

DNA is very important information Where nucleus N Subunit nucleotide A 1. Sugar deoxyribose G Nucleotide (3 parts) 2. phosphate 3. Nitrogen bases (4) N E Nitrogen bases (4) T 1. Adenine A 3. Cytosine C 2. Guanine G 4. Thyamine T Purines Ad Gua pyrimidines Cy Thy I Question- An enzyme helicase cuts

segments of DNA to repair damaged cells. Where in the cell is this enzyme located? nucleus Polymer = DNA -long chain of joining subunits E Note DNA cannot leave nucleus Structure C C O D E Important structure note: Bases always held together by hydrogen bonds DNA is a double helix Watson & Crickmen 2 strands So DNA looks like this Like a ladder Backbone S-P-S-P backbone Repeating S-P-S-P-S-P Bases held together by hydrogen bonds --T A--

Nitrogen bases --C Complementary bases they always go together A= T C= G Hydrogen bonds --A --G --T --A GTCA-- Make the DNA complement Review Make the complement: 1.ATCTAAGCAGGTA TAGATTCGTCCAT 2.TACGGATACCGAAT ATGCCTATGGCTTA Replication DNA synthesis make DNA Word Attack: Synthesis to make Replication makes a copy Why for new cells When interphase Where nucleus R E P L I C

A T I O N How: 1.Enzyme splits it 2.Complement strands made Result Replication makes a copy DNA codes for protein Proteins made on ribs Problem DNA cannot leave nucleus Info must get to the nucleus Solution RNA Review: Transcription RNA ribonucleic acid DNA- ATCGTATCA RNA- UAGCAUAGU 1 Strand Nucleotide (3) 1.Sugar ribose 2.phosphate 3.Nitrogen base *A *G AU CG *C R N * U (uracil) A Made by transcription

Transcription Makes RNA from DNA Where: nucleus DNA- TACCGATCCCATC RNA- AUGGCUAGGGUAG DNAGACCCGTCATCCGGTAATAATCCAT RNA- CUGGGCAGUAGGCCAUUAUUAGGUAU DNA deoxyribonucleic acid 2 strands deoxyribose sugar Bases A=T G=C made by replication cannot leave nucleus RNA . ribonucleic acid 1 strand ribose sugar bases A=U C=G made by transcription nucleus- ribosome Review: DNA Bases- AT, CG RNA . Bases-AU, CG Process- replication Process- transcription Job to make protein

Protein a long chain of amino acids Process translation Translation to make protein by joining amino acids P R O T E I N How to find out what amino acids to use: 1.Use chart 2.Use codons Codon set of 3 nb used to code for AA Lets Practice! CAU His UUU Phe UUA Leu GAA Glu CCC Pro CGC Arg Does chart use RNA or DNA? RNA So If you have CAT? GUA Remember DNA deoxyribose 2 strands AT CG replication cannot leave nucleus RNA . ribose 1 strand AU CG

transcription nucleusribosomes A = T(DNA) A = U(RNA) C= G 3 parts of a nucleotide: 1. sugar 2. phosphate 3. Nitrogen base Replicate: ATCCATGAACTATAG TAGGTACTTGATATC Transcribe: ATCCATGAACTATAG UAGGUACUUGAUAUC 3 types RNA: 1. mRNA: messenger 2. tRNA: transfer 3. rRNA: ribosomal T R A N S L A T I O N Review: 1.Make the DNA complement: CATGACTTAATGCGA GTACTGAATTACGCT 2. Transcribe: CATGACTTAATGCGA GUACUGAAUUACGCU 3.Translate: CAT GAC TTA ATG CGA GUA CUG AAU UAC GCU RNA

mRNA- MESSENGER tRNA TRANSFER rRNA RIBOSOMAL M U T A T I O N THE DOG BIT THE CAT 1.THE DOG BIT THE CAR 2.TED OGB ITT HEC AT_ 1 Point-Substitute: changes 1 amino acid 2 Frameshift: delete/insert. Changes all amino acids DNA Mini Lab Normal hemoglobin vs. Sickled hemoglobin Normal hemoglobin carries oxygen Sickled hemoglobin cannot carry oxygen Why They make different proteins Job: Transcribe and translate the DNA of the 2 types of hemoglobin Normal: GGG CTT CTT TTT Sickled: GGG CAT CTT TTT Using AAT GCC AGT GGT TCC CAC what protein would it make? Contrast replication, transcription and translation: Contrast RNA and DNA: What are the 3 parts of a nucleotide? Father of Genetics: Gregor Mendel Heredity: passing of traits from parents to kids Genetics: study of heredity Traits: characteristics you get from parents Gametes: sex cells

Mom Egg Dad sperm Fertilization- union of sperm and egg Zygote fertilized egg G E N E T I C S Gene: segment of DNA that codes for a protein/trait Allele: choices for a trait/gene Ex: gene- eye color Alleles- brown, blue Dominant Always seen T gene- height alleles- tall short Recessive Can be hidden and skip generations t Law of Segregation: Get 1 allele for each trait from each parent So you end up with 2 alleles for each Since you have 2 alleles for each

gene, you have 2 letters (Remember baby lab) TT homozygous dominant (Tall) Tt homozygous recessive (short) Tt heterozygous (tall) Big letter ALWAYS wins Genotype Phenotype Combo of alleles Tt Bb Physical trait Tall, short How do you predict what offspring will look like? Punnet Square Tool used to predict genotype and phenotype of offspring B=black b=tan Mom - Bb Dad- Bb Looks black Looks black Cross parents Bb x Bb mom dad 1.Draw box 2.Put mom gametes on top. Put Dad gametes on side. 3.Fill in box with a letter from each parent B b 4.Analyze B b

BB Bb Bb bb Dihybrid Crosses 2 different traits/parent B = brown T = tall BbTt Bbtt bbTT BBtt - b = white t = short brown tall brown short white tall white short 3. Pair up letters in the following combinations BbTt 1234 1,3 BT 1,4 Bt 2,3 bT 2,4 bt Notice: never 2 of the same letter in a pair Rules for dihybrids Ex: BbTb x Bb TT 1.Label mom and dad

Mom- BbTt dad BbTT 4. Repeat for Dad BbTT 1,3 1,4 2,3 2,4 BT BT bT bT 2. Take mom and label letters 1-4 5. Draw Punnet square How many squares will you have? BbTt 1234 BbTt x BbTT 4 X 4 = 16 Square: 4 across, 4 down BT Bt bT Bt BT BBTT BBTt BbTT BbTt BT BBTT BBTt BbTT BbTt bT

BbTT BbTt bbTT bbTt bT BbTT BbTt bbTT bbTt 6. Place Moms 4 combos on top 7. Place Dads 4 conbos down side 8. Fill in boxes Each box will have 4 letters Using our example how many offspring will be: BBTT: 2 BBTt: 4 bbTt: 2 BbTt: 4 BbTT: 4 Brown tall: 12 white tall: 4 Q1: T tall R round TtRR x TtRr t short r white TR TR

tR TR TTRR TTRR TtRR TtRR Tr TTRr TTRr TtRr TtRr tR TtRR TtRR ttRR ttRR tr TtRr TtRr ttRr ttRr How many are tall round? 12 What are the genotypes? TTRR TtRR TTRr

TtRr ttRR ttRr Remember combos: 1,3 1,4 2,3 2,4 tR Uses: 1.Forensics 2.DNA obtained from: G E N E T I C T E C H N O L O G Y If know DNA sequences: Other uses of Genetic Technology: 1.Industry 2.Medicine 3.Agriculture Pedigree: a genetic family male female

affected affected married children carrier Carrier: Tt carries the t but is not affected by it P E D I G R E E How is person 7 kin to person 1? Son InLaw How are 6 and 9 kin? Aunt/nephew How is 1 kin to 13? Great grandson How many males? 6 Females? 7 How many affected people? 5 Males? 3 Females? 2 If trait studied is tt short: Give the gen/phen for each person 1 Tt tall 2 Tt tall 3 Tt tall 4 Tt tall 5 tt short 6 Tt tall 7 tt short 8 tt short 9 Tt tall 10 Tt tall 11 tt short 12 Tt tall 13 tt short Persons _5,7,8,11,13_ are short

Recessive Diseases: Practice Pedigrees: Which people are affected? 3, 6 Cystic Fibrosis: -Buildup of mucous in lungs Pedigree: Label each person bb- blue BB or Bb - brown This is a recessive pedigree Because 2 unshaded parents have an affected child Most genetic disorders are caused by: 2 recessive alleles Note: only child affected For a recessive disease to affect a child both parents must be: carriers Carrier: carries the allele but are not sick Cc What % Chance will 2 carrier parents have a sick child? 25% Most genetic disorders are caused by 2 recessive alleles Cystic Fibrosis: -A buildup of mucous in lungs -Affects mostly children Tay-Sachs -affects the brain -Cannot break down lipid/fat -Mostly affects children PKU -found in protein -cannot digest protein - Controlled by diet

H U M A N T R A I T S Dominant Traits: Hitchhiker thumb Unattached ear lobes Thick lips Huntingtons Disease: Causes brain degeneration Affects people 35 to 45 Why do people with Huntingtons have children not know they are sick If you carry the gene for Huntingtons you are affected by it H = has it h = does not 5. If a child with free hanging earlobes has a mother with attached earlobes, could a man with attached earlobes be the father? No Why? No big Fs to give F = free 1. Which is Huntingtons? A Which is cystic fibrosis? B How do you know? f = attached 6. 2.How is Huntingtons different? Older age, dominant 3.Define the following: male

married female carrier 4.What body part is affected by CF? lungs # affected: 6 How are 9 and 6 kin? aunt Gen/phen of person: 2 ff att 7 Ff 3 Ff 9 Ff 4 ff att 11 Ff 13 ff att Blood Type- codominance and multiple alleles Multiple alleles more than 2 choices Type Genotype A AB IA I A IA I i IB IB IBi IA IB O ii B Who did the blood bank

Charles Drew blood transfers If a son has blood type O could a msn with blood type B be Dad if the Mom has A? What % chance do an A (Ia,i) woman and a B (Ibi) man have of having an O child? Humans have 46 Into 23 pairs Karyotype chart of paired chromosomes 23rd pair - sex chromosomes XX - female XY - male The chart shows a normal female C H R O M O S O M E S Chromosomal Diseases: Downs Syndrome 3 on 21st pair -mental and physical retardation D-S male 23 Monosomy 23 female copy Sex-linked diseases

Female XX Male - XY Can a carrier female and an affected male have an affected daughter? Travel on the X Red/Green colorblindness Hemophilia: bleeder. Cannot clot blood Pedigree: Can a normal female and an affected male have an affected daughter? 0 Son? 0 Notice: mom is carrier. Passes it to sons More males affected Why? Female XxX Good X takes over Male XxY Only 1 X and its affected Where does a son get his bad X? mom Who does dad give his bad X to? daughter Primitive Earth Deadly Gases Primitive Earth: NO LIFE

How did life begin? O R I G I N O F L I F E Oparin Hypothesis 3.9 billion years ago This caused 2 things happened: 1. 2. Lightning and carbon in ocean formed: These combined to form _________ Protocell (organic) _________ (simple) ___________ (complex) Urey and Miller Can Oparin be for real? Urey and Miller tested him. How? Evidence for Evolution 1.Fossils- oldest _________ fossil record 2.Biochemistry Result they found 3.Embryology 4.Anatomical Structures

similar vestigial Urey and Miller support Oparin Hypothesis Where: in the __________ Ecology: the study of organisms and their environment Who? ecologist Biotic factors Living Plants, animals, predators abiotic factors Nonliving Sun, dirt, temp 5 levels of ecology: 5 organism population community ecosystem biosphere E C O L O G Y 1. Organism - 1 living thing Ex. 1 giraffe 2. group - 2+ of same species Ex.giraffes 3. community - 2+ different species

Ex. Zebras and giraffes 4. ecosystem - Living and nonliving Ex. Zebra, giraffe, tree, and sun 5. biosphere - Can support life Ex. Sphere = circle Bio = life EARTH! Interactions: 1.Competition- fighting over resources Habitat Niche . Where it lives Ex. In a tree What it does- job Ex. Collect acorns Reduces competition: by having organisms w/ diff niches/needs 2.Predator/Prey Predator: eats Prey: gets eaten Cyclic Prey up, predator up, then prey gets eaten, levels down, predator down from lack of food, then back to beginning as prey makes comeback Density dependent depends on size of population 3. Symbiosis living together, nothing dies Mutualism: 2 (both) benefit Ex. Fish in coral Commensalism : 1 benefit, 1 unaffected :l Parasitism: 1 benefit, 1 harmed Ex. Leeches on a host

Aquatic Water Terrestrial land Aquatic Saltwater Freshwater Ocean Pond, lake Photic Light shallow Aphotic No light deep Plankton/PhytoplanktonNorth pole Terrestrial tundra taiga Temp forest grassland desert TRF temp equator B I O M E S 2 most important factors 1. temp 2. precip Tundra - coldest -permafrost:

-ground permanently frozen -little vegs -furry animals Temperate Forest - mod. Temp, rain -deciduous: lose Leaves in winter -seasonal Taiga Northern coniferous forest -cold -snowy -conifer: evergreen trees, makes cones Grassland -mod temp/rain -grazing animals -crops- corn, wheat Desert Tropical Rain Forest -hot -hot -arid-dry -rainy -conserve H2O -most plants -Nocturnal: sleep -year round growing in day seasons -Burrow: in -most biodiversity ground BIOME PROJECT Instructions: Create a brochure, booklet, or PowerPoint to illustrate the characteristics of your biome. Be sure to include all required information and be neat and creative. Due Date: ________ Grading Criteria: _______ Name of Biome (5 pts)

_______ Definition of Biome (5 pts) _______ Map of earth identifying the biome (5 pts) _______ Climate (including temperature, rainfall, seasons, etc) (6 pts) _______ Why is this biome different from the others? (3 pts) _______ Plants (2 = 2 pts, 3-4 = 3 pts, 5 = 4 pts 6+ = 5 pts) _______ Animals (2 = 2 pts, 3-4 = 3 pts, 5 = 4 pts 6+ = 5 pts) _______ Adaptations needed to survive (3 pts) _______ Food web of the biome (chain=2 pts, 5 step web =3 pts, 7+ step web= 5 pts) _______ Positive/Negative Affects Man has had on biome (2 pts each) _______ Include graphs where needed (0=0 pts, 1=1 pts, 2=2 pts, 3+=3 pts) _______ Include illustrations where appropriate (0=0 pts, 1-2= 1 pt, 3-4= 2 pts, 5+=3 pts) _______ Creativity and Neatness and Color (5 pts) _______ Bibliography (at least two books from the library) (10 pts) _______ Grade (65 point max) Be sure your project is colorful and that you have used proper spelling and grammar. Graphs and pictures should be used where needed to support your information. Please feel free to include any other interesting facts about your biome. Try your best and gather the needed information. Limiting factor: anything that prevents some things from living in an area Abiotic: temp, rain, soil Biotic: food, predators Adaptation something an organism has to survive in the environment Tolerance ability to withstand change L I M I T S Population growth: Slow in beginning, speeds up S-curve Above cc too many, some die

Below cc room for more Succession changes in a community & carrying capacity levels off Carrying Capacity: max amount of individuals the environment can support C H A N G E S Primary New place Slow Pioneer species Secondary After disaster (forest fire) Faster b/c already has life Order and soil 1 pioneer species (lichen/moss) 2 grasses 3 bushes 4 pine trees 5 hardwood trees All living things must have energy in order to maintain homeostasis #1 Energy Source= SUN Autotroph makes own food, get E from sun photosynthesis

Ex. plants autotrophs= producers Heterotroph eat food for energy cannot make E Ex. animals Heterotrophs = consumers E N E R G Y Types of heterotrophs 1.Herbivore: eats plants Ex. Deer, cows 2. Carnivore: eats meat Ex. lions 3. Omnivore: eats both Ex. Bear- berry, fish 4. Scavengers: eat dead stuff Ex. buzzards 5. Decomposers: biodegrade things Ex. Bacteria in a dumpster Only 10 percent of energy goes to the next level. The rest is either used or lost as heat. SUN Scavengers, decomposers As move up the pyramid energy is lost so the amount of energy decreases. Must be replaced by the sun. 4th trophic level.

3rd heterotroph. Carnivore- eats carnivores 3rd trophic level. 2nd heterotroph. Carnivore- eats herbivore 2nd trophic level. 1st heterotroph. Herbivore- eats plants 1st trophic level. Autotroph- plant. Producer. Trophic Level = Energy Level. Matter is Recycled Water Cycle B D C A: evaporation B: condensation C: precipitation D: transpiration A M A T T E R Carbon CO2 CO2 A D O2 B

Food C a. Plants take in CO2 photosynthesis b. We breathe in O2 from plant c. We eat food from plant d. We breathe out CO2 cellular respiration Pollution bad CO2 into air Extinct 0 No more living Endangered Numbers close to 0 Threatened Decrease in population Threats Habitat Loss- remove habitat Effect- no place to live Ex. deforestation Habitat Fragmentation- separate Effects edge effect encroachment T H R E A T S Habitat Degradation- to make unlivable -pollution Effects: acid precipitation- lower pH of

water less ozone- more harmful UV rays more CO2 greenhouse effect CO2 traps heat greenhouse/ global warming Exotic Species do not belong no predators reproduce and spread out of control Conservation Biology- to save biodiversity Legal - CITES - US endangered species act Preservation - parks- Yellowstone - preserves - Sustainable use- use wisely -Habitat corridors -Connect pieces of land -Overcomes habitat fragmentation C Reintroduction programs -put things back in their natural O habitat Ex. condors N Harmed by DDT(pesticide) Effect- thin eggs S Captivity- under human control E Problem with reintroduction R programs: - Lose natural instinct V PROTECT!! A CONSERVE!! T SAVE THE PLANET!!

I O N 5 5 Theory: supported evidence 7 Unit 5 Review Characteristics of living organisms Cells/DNA reproduce grow/develop homeostasis adapt Law: untestable fact Independent Variable: tested Levels of Ecology organism population community ecosystem biosphere Symbiosis: :/ Steps of scientific Method problem hypothesis experiment data result

conclusion R/R- repeat Dependent Variable: measured Biotic Living Abiotic Not living Habitat Where Niche Job Ecology Study of Pyramid of energy (trophic levels) Energy: runs out 5th: Scavengers 4th 3rd het: carn eat carn 3rd 2nd het Carn eat herb 2nd 1st het

Herb eat plant 1st Autotroph Plant= producer Autotroph Heterotroph Food Chain Producer plant Consumer animal Food Web B CO2 increases CO2 Decreases Breathe in trees pollution D C A A: evaporation B: condensation C: precipitation D: transpiration Nitrogen Fixation: fix N to make variable bacteria, plants Energy runs out Matter is recycled

Limiting Factor: prevents life Tolerance: withstand change Succession: Primary Secondary new After disaster Forest fire Aquatic: Marine Freshwater Saltwater/ocean Lake/pond Photic Aphotic Interdependent Light shallow Deep No light Start of food chain, must be producer tundra taiga Temp forest grassland

Desert TRF Island Theory 1. Small island has less BioDiv 2. Closer to equator, has more BioDiv Tundra: permafrost Taiga: northern coniferous forest Grassland: crops, grazers Forest: seasonal deciduous Desert: hot and conserve H2O Rainforest: hot rainy most BioDiv Biodiversity: number of different types of species Extinct: 0 Habitat Loss: remove Endangered: close to 0 Habitat Fragmentation: separate Threatened: rapid population drop Habitat Degradation: pollute Exotic Species: invade

Global Warming: raises temp. CO2 traps heat Sustainable Use Habitat Corridor Captivity Reintroduction Use wisely Connects separated land Under human control Help put back Conservation: Linear J Curve S Curve Rate: constant Rate: exponential Rate: exponential with leveling off Not population Unlimited resources realistic Rapid life history:

think mosquito small lots of babies short lives little care Short life history: think elephant large few babies long lives more care Carrying Capacity: max # environment can support Demography Age Structure Emigration Human population # of people at each exit age group Competition up when: 1. Population up 2. Resources down immigration into

Recently Viewed Presentations

  • Ch. 10 Age of Democracy and Progress

    Ch. 10 Age of Democracy and Progress

    Governments caught on with the trend and developed plumbing and sewer systems to improve public health. Ideas in Science. Charles Darwin developed the Theory of Evolution in 1859. Theory of Evolution
  • Automotive Photometry - CIE

    Automotive Photometry - CIE

    CIE Australia Website Report to CIE Aus AGM 2010 Summary Website content continues to be updated CIE News, new publications shown Division page expanded somewhat to now include division reports, ballots, etc. Site Traffic Average approx. 3 hits per day...
  • Stress: the triggering factor of cardiovascular disease

    Stress: the triggering factor of cardiovascular disease

    The Myogenic Theory supports the use of cardiac glycosides (cardiotonics) for the prevention and clinical treatment of acute coronary syndromes. Among other developments are the Ventricular Aneurism Surgery of the Heart performed by Charles Bailey in 1954 and the first...
  • Ohio National Guard

    Ohio National Guard

    Dual Status phased conversion timeline will be coming from NGB. Positions identified for conversion have not been established. Staffing Updates New USA Staffing System All RFF's received since 1 May 2017 will be announced using the new USA Staffing system....
  • Enslavement in the Classical World - White Plains Public ...

    Enslavement in the Classical World - White Plains Public ...

    Enslavement in the Classical World. ... Perhaps some context might help. Bias/POV. In at least four documents you must: ... of Manu provided a religious justification for the society which had fewer slaves than the Mediterranean due to its caste...
  • Faces of Modern American Literature—a Transnational and ...

    Faces of Modern American Literature—a Transnational and ...

    They did this to elude their enemies and American officials, all those who were potential threats to them" (46). b. "I'm invisible" "I've stolen my brother's name. I've lost my own name and replaced it with a dead boy's. I...
  • Boys Education - Jamaica Teachers' Association

    Boys Education - Jamaica Teachers' Association

    For over 40 years the Western Hemisphere has been experiencing the phenomenon of academic underperformance among its male population. Research in the last 25 years including that done in Jamaica( Miller, Evans, Bailey, Clarke) has sought to explain the reasons...
  • Rafael Alberti - Tor Vergata - DidatticaWeb 2.0

    Rafael Alberti - Tor Vergata - DidatticaWeb 2.0

    ¡Miradme, que pasa el mar! El alba del alhelí Scritto quasi in contemporanea con La amante Forte presa sulla realtà (la vita del paese, Rute, dove ha vissuto per qualche tempo) L'anneddotico Narratività e drammatizzazione (Estampitas…) I tre "alhelí": bianco,...